Index
Home
About
[Original Post that started the Blood Analysis thread, around 7 Nov 1990]
From: Walter Henry ( whenry@lindy.stanford.edu )
>A colleague at another library has asked what I think is a rather
>interesting question. Her institution has a manuscript that was
>ostensibly signed in blood in the 17th century and we are trying to
>think of a way to verify whether this is the case. Does anyone know of
>a test that would identify blood (or its components) that
> a) requires only microsamples?
> b) might work on a sample that is 300 years old?
>Any suggestion, or pointers to literature would be most welcome.
>I do recall something of the sort in a rather noxious popular book on
>the Shroud of Turin and will try to find that, and I dare say the
>Forensic literature is rife with such matters, but alas I don't have
>much access to such arcana.
>Thanks,
>Walter Henry
....
Article 2451 of sci.chem:
From: John G. DeArmond <jgd@rsiatl.UUCP>
Date: 11 Nov 90
Organization: Radiation Systems, Inc. (a thinktank, motorcycle, car
and gun works facility)
...
You might want to look at X-ray Fluorescence Analysis which works by
stimulating the unknown with X-rays and analysing the fluorescence that
results. With the proper equipment and software, it is possible to
"strip away" layers of thin film, such as on hard disk platters and
make chemical analyses to 2 decimal point resolution. Low Z materials
such as the constituents of paper do not show up and/or easily
filtered. We just finished a project that involved building some
portable instruments for the Smithsonian. You could contact them or I
could put you in touch with my colleague who is a recognized expert in
the field.
John
--
John De Armond, WD4OQC | "Purveyors of Performance Products
Rapid Deployment System, Inc. | to the Trade " (tm)
Marietta, Ga |
{emory,uunet}!rsiatl!jgd | "Vote early, Vote often"
Article 1276 of sci.chem:
From: Larry Lippman <larry@kitty.UUCP>
Summary: Limitations of x-ray fluorescence
Date: 24 Nov 90
Organization: Recognition Research Corp., Clarence, NY
In article ..., jgd@rsiatl.UUCP (John G. DeArmond) writes:
> You might want to look at X-ray Fluorescence Analysis which works by
XRF (x-ray fluorescence) is a technique used for elemental analysis
above a Z (atomic number) of 8 or so. Therefore, it cannot readily
detect the common elemental constituents of organic materials such as
carbon, hydrogen, oxygen and nitrogen. Special XRF apparatus using a
vacuum chamber has been able to detect elements with a Z as low as 5
(boron), but this is not a particularly sensitive, convenient or
reliable technique.
While it is obvious that the heme molecule contains iron, XRF
cannot readily discriminate between heme and say, an ink containing
just iron oxide (like red ocher). While XRF may be able to
affirmatively identify certain inks with compositions comprising
multiple elements above atomic number 8, it cannot affirm or deny the
presence of blood with any reasonable degree of certainty. A good
example of XRF for ink identification is the inks used to print
currency, which have far more elements that one might imagine; a
typical dollar bill contains: titanium, barium, lead, chromium, iron,
cobalt, zinc and tungsten!
XRF is quite useful for identification and authentication of many
inks and pigments in documents, paintings, and other archaeological
objects. But it just won't do blood.
Now that we have dispensed with XRF, there *is* another x-ray
method which can affirmatively identify blood - but it's not very easy.
XRD (x-ray diffraction) can identify the specific structure of the heme
molecule, and was in fact used by John Kendrew during the 1950's to
discover the precise structure of hemoglobin.
However, sample preparation for XRD requires some destruction of
the article under investigation. In addition, it is necessary to
separate the ink (or blood) from the paper and any other materials to
minimize the number of unknowns. XRD can usually deal with binary
mixtures, but beyond that it become extremely complex, if not
impossible. The sample, possibly mixed with a binder, is placed in a
capillary tube or molded, and then inserted within the XRD camera.
While XRD may be used to affirmatively identify heme, it is not a
simple process. Some considerable computer-aided analysis of XRD
patterns is required. The complete structure of hemoglobin results in
XRD patterns with over 25,000 reflections!
> We just finished a project that involved building some portable
> instruments for the Smithsonian.
Interesting. I know some people at both the Freer Gallery and the
Museum Support Center in Suitland, MD. I'll have to ask them about
your project.
Larry Lippman @ Recognition Research Corp. "Have you hugged your cat today?"
VOICE: 716/688-1231 {boulder, rutgers, watmath}!ub!kitty!larry
FAX: 716/741-9635 {utzoo, uunet}!/ \aerion!larry
Article 1277 of sci.chem:
From: Larry Lippman <larry@kitty.UUCP>
Summary: ARCHAEOLOGICAL dating by amino acid racemization measurement
Date: 24 Nov 90
Organization: Recognition Research Corp., Clarence, NY
In article <...>;, mikew@sanjuan.wrcr.unr.edu (Mike Whitbeck) writes:
> I find this interesting! I have had casual inquiries from
> ARCHAEOLOGISTS about this. As far as I know the simple forensic tests
> (field tests) simply check for iron-- not terribly specific.
Not iron, really, but many of the simple tests involve peroxidase
reactions of hemoglobin (as I have described in a recent article). The
only test which particularly reacts to iron is luminol - this test is
seldom used anymore due to its propensity for interference from other
metallic sources.
> The question that must be answered is 'Can blood proteins, in whole or
> sufficiently unique fragments survive over 300 years?'
Sure! In fact, organic materials can often be dated by measurement
of the extent of racemization of certain amino acids in its constituent
proteins. An example of such a racemization reaction having a
half-life of approximately 100,000 years is: L-isoleucine --
D-alloisoleucine. Another racemization mechanism is L-aspartic acid
-- D-aspartic acid, which has a half-life of approximately 17,500
years.
So, clearly if we can date proteins to 100,000 or more years, we
can certainly take other measurements using 300-year old blood.
>If the answer is yes then by all means talk to a
>biochemist about electrophoresis or chromatographic methods.
Unfortunately, there are some limitations. While we can identify
certain proteins and such substances as hemoglobin (heme, actually),
many of the characteristic enzymes, antigens and globulins in blood are
long destroyed by age. However, sufficient fragments exist such that
amino acids and other components may still be identified.
Larry Lippman @ Recognition Research Corp.
VOICE: 716/688-1231 {boulder, rutgers, watmath}!ub!kitty!larry
FAX: 716/741-9635 {utzoo, uunet}!/\aerion!larry
Article 1291 of sci.chem:
From: Larry Lippman <larry@kitty.UUCP>
Summary: Identification of blood stains
Date: 24 Nov 90
Organization: Recognition Research Corp., Clarence, NY
In article <...> tjbryce@amherst.bitnet writes:
...
>You might consider testing the wavelength at which the "blood" absorbs
>light. Hemoglobin absorbs light at very specific frequencies, which would
>be a useful fingerprint to tell the "blood" apart from ink.
I agree with the above advice. A microspectrophotomet is an
instrument which couples a traditional scanning UV/VIS/NIR
spectrophotometer to a microscope, and can facilitate both transmissive
and reflective measurements. In a viewing mode the microscope eyepiece
is used to position the instrument to the desired location on the
sample, at which point a movable mirror is operated to connect the
spectrophotometer in place of the eyepiece. Since one must use a more
complex optical path through a microscope, the wavelength of a
microspectrophotomet is limited to not much more than 1100 nm at the
high end, and not much less than 300 nm at the low end.
Zeiss makes a series of microscopes called "Zonax" which offer
scanning @spectrophotometric capabilities. A computer with color
monitor is used to process and display various types of
spectrophotometric data representations. My organization had a Zeiss
Zonax system for almost two years as GFE; unfortunately, we had to
return it at the conclusion of the contract. :-) This particular model
was really slick, although its spectral range was limited to 400 to 700
nm. Newer models have greater spectral range. Zeiss Zonax systems are
rather pricey, however; the model we had sold for around $ 60 K.
Getting back to the specific issue of blood, hemoglobin has two
very specific absorption bands at 540 and 578 nm, with a minimum
absorption at 560 nm. Not only can such spectrophotometric data be
used for determination of the presence of blood, but work by Kind,
Patterson et al has developed methodology for the spectrophotometric
*dating* of blood. In this case, a small amount of a bloodstain is
dissolved in a dilute solution of ammonium hydroxide, and a complete
spectrophotometric scan is made. Analysis of the spectrophotometric
curve is used to arrive at an approximate age of the bloodstain.
Further details on this process is in the literature.
In the particular case of authenticating the document in question,
I would suggest that a spectrophotometric determination be made along
with at least one *other* test. The following are general suggestions
for such an additional test (explicit test details are readily found in
the literature and in textbooks on forensic science). Sampling for
these tests can be relatively non-destructive through scraping of a
small sample of suspected blood, or through the use of moistened filter
paper to absorb a sample of the suspected blood.
1. Methylated benzidine test, which can detect blood in concentrations
as low as 10 ppm.
2. Kastle-Meyer phenolphthalein test, which while less sensitive than
the methylated benzidine test, is surprisingly immune to
interference (except for a few fruit and vegetable materials).
3. Takayama hemochromogen test, which uses pyridine to cause the
reduction of hemoglobin, resulting in characteristic salmon-pink
crystals of pyridine hemoglobin observable under the microscope.
Unfortunately, at this point, even if we achieve affirmative
results from the above tests, we are faced with another problem: is the
blood *human*?
With blood stains that are less than a few months old, this is not
usually a problem, and various procedures exist for such
determinations. A common test uses what is called anti-human
precipitating antiserum. There is, however, a common interference
problem with such precipitin tests resulting from tannin in wood, paper
and leather. This may or may not be a problem with the document in
question. The use of anti-serum tagged with fluorescent dye, and the
making of observations under a microscope with UV illumination may aid
in precipitin testing. Another problem, though, is that anti-human
serum will not differentiate between human and primate blood - however,
I would probably not lose any sleep over this remote possibility. :-)
There is a gel electrophoresis procedure whereby the albumin and
non-gamma globulins of the samples are made to migrate toward the gamma
globulins of the selected anti-sera (usually a selection of anti-human,
anti-cow, anti-pig, anti-dog, etc.). Positive results are indicated by
a precipitation line.
Unfortunately, it is highly doubtful that 300-year old blood stains
can be species-identified (let alone ABO-typed) by *any* method. Many
antigens, such as M and N factors are destroyed within several weeks.
Various isoenzymes and serum proteins (like Hp, AK, PGM, EAP, etc.) are
also destroyed within a few months. I have, however, heard it claimed
that if blood dries quickly and *remains* dry, the A and B antigens
will remain stable almost indefinitely.
The oldest antigen identification that I have heard of occurred in
the U.K. after a period of ten years. This specimen actually contained
a dried crust of blood, as opposed to a stain - so the greater quantity
may have been a factor.
While I feel confident that 300-year old blood can be reliably
identified *as blood*, I am highly doubtful that any species
identification can be made. I don't know if that is sufficient
authentication for the document in question.
Larry Lippman
Article 1292 of sci.chem:
From: Roy Smith < roy@phri.nyu.edu >
Date: 25 Nov 90
Organization: Public Health Research Institute, New York City
larry@kitty.UUCP (Larry Lippman) writes:
> I feel confident that 300-year old blood can be reliably identified
> *as blood*, I am highly doubtful that any species identification can
> be made.
Would it be possible to recover enough DNA to do PCR on it? I seem
to remember reading something about doing PCR on DNA from a frozen
quagga (a zebra-like beast which became extinct in the last ice age,
now only found on "rogue" games). The quagga DNA was O(10,000) years
old, which is considerably older than 300 years, but perhaps freezing
is a better method of preserving than drying on paper?
Assuming you could do PCR, how hard would it be to determine the
species? The most likely other candidates would probably be some sort
of food animal, such as cow, pig, or chicken (or whatever animals they
were eating 300 years ago; the point is, other primates would be
unlikely). Actually, it just occurred to me that red blood cells don't
have DNA, if I remember correctly, but maybe some other component of
blood does?
...
--
Roy Smith, Public Health Research Institute
455 First Avenue, New York, NY 10016
roy@alanine.phri.nyu.edu -OR- {att,cmcl2,rutgers,hombre}!phri!roy
"Arcane? Did you say arcane? It wouldn't be Unix if it wasn't
arcane!"
Article 1295 of sci.chem:
From: Jeff Forbes <forbes@aries.scs.uiuc.edu>
Date: 25 Nov 90
Organization: School of Chemical Sciences,
Univ. of Illinois at Urbana-Champaign
In article <...> roy@phri.nyu.edu (Roy Smith) writes:
> Actually, it just occurred to me that red blood cells don't have DNA,
> if I remember correctly, but maybe some other component of blood does?
You are correct. Mammalian erythrocytes do not have a nucleus and
therefore no DNA. Other cellular components of blood do have a nucleus,
but the concentration is much less than the erythrocytes. Avian
erythrocytes do have a nucleus.
Jeff Forbes
"....I have not failed. I've just found 10,000 ways that won't work."
Thomas Edison
Article 1298 of sci.chem:
From: Andrew Taylor ( andrewt@cs.su.oz )
Date: 25 Nov 90
Reply-To: andrewt@cluster.cs.su.oz (Andrew Taylor)
Organization: Basser Dept of Computer Science
University of Sydney, Australia
...
Quaggas became extinct about 100 years ago (in Southern Africa). Maybe
you have the wrong animal?
Article 1300 of sci.chem:
From: Mike Whitbeck < mikew@sanjuan.wrcr.unr.edu >
Date: 26 Nov 90
Reply-To: mikew@sanjuan.UUCP (Mike Whitbeck)
Organization: DRI-WRC Reno
I recently read an article in the newspaper that some
archaeologists were using serum antigens to ID very old blood
with species identification.
______________________________.
| mikew@wheeler.wrc.unr.edu |
|__RENO___NEVADA_______________|
Article 1302 of sci.chem:
From: Larry Lippman <larry@kitty.UUCP>
Summary: Unlikelihood of DNA sequencing from old, dried blood
Date: 26 Nov 90
Organization: Recognition Research Corp., Clarence, NY
In article <...> roy@phri.nyu.edu (Roy Smith) writes:
> larry@kitty.UUCP (Larry Lippman) writes:
> Would it be possible to recover enough DNA to do PCR on it?
I don't believe that any DNA fragments would exist in the dry
condition of a 300-year old blood stain, notwithstanding the fact that
mature mammalian erythrocytes don't have a nucleus, mitochondria,
ribosomes, etc. Leucocytes are a true cell with a nucleus and DNA, but
I rather doubt that any would be found in a 300-year old blood stain.
I can't offer any authoritative comments on DNA issues, though. I
don't do DNA, genetic mapping or any aspect of molecular biology. I
have enough trouble maintaining competency in selected more traditional
aspects of chemistry and biochemistry! :-)
> Actually, it just occurred to me that red blood cells don't have DNA,
> if I remember correctly, but maybe some other component of blood does?
As far as I can recall, no *mature* mammalian erythrocytes possess
DNA. Erythrocytes of birds, reptiles, etc. do have a nucleus with DNA
and all the trimmings, though. ...
Larry Lippman
Article 1310 of sci.chem:
From: Eric E. Snyder < eesnyder@boulder.Colorado.EDU >
Date: 27 Nov 90
Organization: University of Colorado, Boulder
...
In article <...> larry@kitty.UUCP (Larry Lippman) writes:
>In article <...> roy@phri.nyu.edu (Roy Smith) writes:
>> Would it be possible to recover enough DNA to do PCR on it?
> I don't believe that any DNA fragments would exist in the dry
> condition of a 300-year old blood stain.....
I bet there would be PCRable DNA fragments.... Remember that DNA is a
remarkably stable molecule (even in my hands). Furthermore, PCR only
requires a few molecules of template to give a signal... that is not
too much to ask. One could easily do species ID by selecting a highly
polymorphic locus such as beta-casein and sequencing the amplified
product.
TTGATTGCTAAACACTGGGC
Eric E. Snyder
Department of MCD Biology We are not suspicious enough
University of Colorado, Boulder of words, and calamity strikes.
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAl
Article 1328 of sci.chem:
From: Keith Conover < ireland@ac.dal.ca >
Date: 27 Nov 90
Organisation: Dalhousie University, Halifax, Nova Scotia, Canada
In article <...>, andrewt@cs.su.oz (Andrew Taylor) writes:
> In article <...> roy@phri.nyu.edu (Roy Smith)
>>...
>> to remember reading something about doing PCR on DNA from a frozen
> quagga Quaggas became extinct about 100 years ago (in Southern
> Africa). Maybe you have the wrong animal?
If I remember correctly, two different experiments are being confused
here. The quagga DNA came from a museum specimen, possibly a hide. The
PCR done on DNA isolated from a beast which was frozen and extinct from
the last ice age came from a wooly mammoth.
Keith Conover
Article 1337 of sci.chem:
From: David Throop <throop@cs.utexas.edu>
Date: 29 Nov 90
Organization: Dept of Computer Sciences, UTexas, Austin
Walter Henry is trying to validate a claim that a particular document
was signed in blood 300 yrs ago.
Walter, can you be a little more specific? Are you trying to
determine-
- That the signature is really in blood?
- That the signature is really in human blood?
- That the signature is really in the human blood of the putative
author?
- That the signature is really 300 yrs old?
- That the signature is really in the handwriting of the putative
author?
- That the signature in blood is legally binding for the sale of a
human soul?
Really, Walter, if you're going to have us help on this, you should
at least tell us the good parts. What kind of a document gets signed
in blood? Or did the guy's quill pen just happen to be dull that day?
This has got to be juicy.
I'll assume that you are trying to prove that the signature is really
in blood, but that you'd be willing to risk being fooled by other
mammalian blood, and that you'll fix the document's age by other means.
The methods advanced so far [various x-ray methods to detect iron and
PCA reactions on the DNA] seem inadequate - in particular, I doubt
you'll get any kind of a reading of the x-ray because of gross
contamination, and, as others have pointed out, you may well not get
any DNA from blood.
I'd suggest gas chromatography/mass spec. I remember articles circa
1979 about using GCMS to identify different bacterial strains - they'd
culture the bacteria, take a couple of micrograms, inject the sample
into a very hot chamber for flash pyrolysis, and then routed the
pyrolysis products to the gc column, then ms. The pyrolysis signatures
had enough detail (and were repeatable enough) that they could tell
different strains of the same organism apart, but still identify a
broad range of pathogens.
And of course, GCMS is much more forgiving of contamination than other
methods, because if you see the same GC peaks as the pure sample, and
those peaks have the same MS signatures as the pure sample, you've got
a positive no matter what other garbage comes out in the other peaks.
And GCMS works with extremely small sample sizes.
I'd think that this approach would certainly be good enough to pick out
blood from non-blood, and probably human from non-human blood.
But finally, I'd say check in with a forensic pathologist - crime lab
folks. They work with identifying blood from contaminated samples all
the time. They've probably got lots of techniques that us general
chemistry types wouldn't know about.
David Throop
Article 1378 of sci.chem:
From: Larry Lippman <larry@kitty.UUCP>
Summary: Analytical methods employing pyrolysis with GCMS
Date: 5 Dec 90
In article <...>, throop@cs.utexas.edu (David Throop) writes:
> I'd suggest gas chromatography/mass spec. I remember articles circa
> 1979 about using GCMS to identify different bacterial strains - they'd
> culture the bacteria, take a couple of micrograms, inject the sample
> into a very hot chamber for flash PYROLYSIS, and then routed the
> PYROLYSIS products to the gc column, then ms. The PYROLYSIS
> signatures had enough detail (and were repeatable enough) that they
> could tell different strains of the same organism apart, but still
> identify a broad range of pathogens.
I do not believe that PYROLYSIS followed by GCMS will be of any use
for identification of blood. PYROLYSIS has its place for the
identification of functional groups through the creation of smaller
molecules such as: CH4, C2H4, C2H6, CO, CO2, NH3, H2S, H2O, etc. The
identification of blood is based upon the characteristics of a
*structure* - hemoglobin. Don't forget that as a complex protein,
hemoglobin has an m.w. of around 65,000. Mere functional group
identification analysis (in this case not that much better than simple
CHNO determination, for that matter) is not likely to create an a
priore basis to differentiate hemoglobin from say, myoglobin, serum
albumin, or other organic materials.
PYROLYSIS followed by GCMS is a useful technique in forensic
science, but not for identification of blood or other body fluids.
PYROLYSIS followed by GCMS is useful for rapid toxicology screening
(where one has *real* unknowns!), especially when such GCMS results are
compared to standards by means of Kovats retention indices (much work
has been done along such lines).
> And of course, GCMS is much more forgiving of contamination than other
> methods, because if you see the same GC peaks as the pure sample, and
> those peaks have the same MS signatures as the pure sample, you've got
> a positive no matter what other garbage comes out in the other peaks.
> And GCMS works with extremely small sample sizes.
The above is generally true.
> I'd think that this approach would certainly be good enough to pick
> out blood from non-blood, and probably human from non-human blood.
If we had a *singular* unknown and compared a standard sample of
blood to an unknown sample which bore no relation to blood (such as
ink), I would agree. However, there are too many unknown factors due
to the age of the document, its material and potential impurities
(paper, parchment, coatings, etc.) to be confident of any such
identification.
With respect to differentiation of "human from non-human blood", I
don't believe there is a prayer of a chance that such identification
can be made using GCMS - provided that we are comparing human to other
mammalian blood.
PYROLYSIS followed by GCMS has an outstanding application: the
identification of polymers, especially mixed polymers.
Larry Lippman
***********************************************************************
Index
Home
About